Practice Test

Q1) Co-repressor is a: Show Answer

Q2) Reverse transcription was discovered by: Show Answer

Q3) In the Operon concept, the regulator gene regulates chemical reactions in the cell by: Show Answer

Q4) Central dogma of cytogenetics is: Show Answer

Q5) In an E. coli according to Operon concept, an operator gene combines with: Show Answer

Q6) Exons and introns are parts of: Show Answer

Q7) Eukaryotes have: Show Answer

Q8) According to Operon concept, regulator gene form: Show Answer

Q9) Which virus has a double stranded RNA? Show Answer

Q10) In lysogenic cycle, the virus is: Show Answer

Q11) In bacteria, exchange of genetic material between two different cells is brought by the process of: Show Answer

Q12) Phage host represents: Show Answer

Q13) Regulated unit of genetic material is called: Show Answer

Q14) A retrovirus is: Show Answer

Q15) Bacteriophages are: Show Answer

Q16) Provirus differs from prophage with regard to: Show Answer

Q17) Which virus has a rod shaped structure? Show Answer

Q18) Oncogenic viruses are harmful in: Show Answer

Q19) Which of the following viruses have been extensively used to fuse cells in tissue culture: Show Answer

Q20) Thalessemia is an example of: Show Answer

Q21) Who found occurrence of sexuality in bacteria? Show Answer

Q22) Operon consists of following: Show Answer

Q23) Restriction enzymes are used in genetic engineering because: Show Answer

Q24) Wild type E.coli cells are growing in a normal medium with glucose. They are transferred to medium containing only lactose as the sugar. Which one of the following changes take place? Show Answer

Q25) An environmental agent that triggers transcription from an operon is a: Show Answer

Q26) The lac operon is an example of: Show Answer

Q27) In split genes, the coding sequences are called: Show Answer

Q28) In case of cyanobacteria: Show Answer

Q29) The sequence of structural genes of Lac operon is: Show Answer

Q30) Which virus has a single stranded DNA: Show Answer

Q31) Resistance to antibiotics is a genetic trait that spreads naturally from one type of bacterium to: Show Answer

Q32) Reverse transcriptase is: Show Answer

Q33) Transduction in bacteria is mediated by: Show Answer

Q34) The nuclease enzymes which begins its attack from a free end of a polynucleotide: Show Answer

Q35) Normally, DNA molecule has A-T, G-C pairing. However these bases can exist in alternative, valency consistent status, owing to rearrangement called: Show Answer

Q36) When DNA is exchanged between two bacteria via cytoplasmic bridges, the process is called: Show Answer

Q37) In general, bacterial genes are regulated at the time of: Show Answer

Q38) The activity of a repressor depends on whether: Show Answer

Q39) In gene therapy, DNA is inserted in a cell to compensate for: Show Answer

Q40) A gene carried by recombinant DNA is cloned when: Show Answer

Q41) A piece of nucleic acid used to find a gene, by forming a hybrid with it, is called as: Show Answer

Q42) Which of these viruses has DNA that occurs in both linear form and circular form? Show Answer

Q43) Palindromic sequence are recognized by enzymes: Show Answer

Q44) Which of the following is a palindromic sequence of nucleotides? Show Answer

Q45) Which is not an oncogenic virus? Show Answer

Q46) Restriction enzymes are nucleases and: Show Answer

Q47) Which is must for genetic engineering? Show Answer

Q48) Restriction endonuclease enzymes (RE) also called microscissors are widely used in genetic engineering. They cleave up foreign DNA at specific sites. These enzymes are synthesized by: Show Answer

Q49) Restriction endonuclease are enzymes discovered by Arber and Mathani (1962) and obtained from bacteria only. They are used as microscissors in genetic engineering. They recognise specific sequence of bases at a particular site, usually 4-6 base pairs and: Show Answer

Q50) Sticky ends of DNA strand are: Show Answer

Q51) Eli Lilly and Co. is famous for: Show Answer

Q52) Callus and cancer both are undifferentiated mass of cells formed by uncontrolled mitosis. They differ as: Show Answer

Q53) One important consequence of interference of gene expression by another gene may be: Show Answer

Q54) In the Tryptophan operon, Tryptophan acts as: Show Answer

Q55) Enzymes required at the time e.g., for respiration are called: Show Answer

Q56) Two scientists working in Pasteur Institute proposed a gene action model and got Nobel Prize in 1965. Names: Show Answer

Q57) The gene which increases the frequency of mutation in other genes is called: Show Answer

Q58) There is no masking in expression of genes in Neurospora, because it: Show Answer

Q59) Human growth hormone is now produced in large quantities by recombinant DNA technology. The previous source of this hormone, for treating pituitary dwarf, was: Show Answer

Q60) How does gene expression occur in prokaryotes? Show Answer

Q61) A community of similar individuals living a circumscribed area at a given time and capable of interbreeding is called: Show Answer

Q62) A split gene is: Show Answer

Q63) Gene expression in eukaryotes at a time never exceeds: Show Answer

Q64) Retroviruses are implicated as a cause for cancer in humans because they: Show Answer

Q65) When lactose is present: Show Answer

Q66) Introns occurs in: Show Answer

Q67) According to 1991 figures, about how many human genes have been mapped? Show Answer

Q68) Lac, operon of E. coli contains in continuity: Show Answer

Q69) Bacterial resistance to antibiotic is a genetic trait carried in the bacterial: Show Answer

Q70) In a tryptophan operon model, formation of tryptophan is restricted by: Show Answer

Q71) How many types of the genes the Lac operon model includes: Show Answer

Q72) In a lac-operon model, the addition of lactose induces the synthesis of: Show Answer

Q73) A collection of clones (genetically similar cells/organisms) having recombinant DNA is called: Show Answer

Q74) Hybrids are often superior to either parents due to: Show Answer

Q75) Dr. Hargobind Khorana has been awarded Nobels prize for research on: Show Answer

Q76) Two strains of bacterial suspensions are separated from one another with the help of bacteria proof glass filters, which of the following process would not occur? Show Answer

Q77) Each codon present on m-RNA and anticodon present in t-RNA is composed of: Show Answer

Q78) Which of the following unit is unrelated to DNA or gene? Show Answer

Q79) The basis for DNA finger printing is: Show Answer

Q80) The Nobel prize of physiology and medicine in 1989 was awarded to: Show Answer

Q81) The recent techinque used for separating fragments of DNA is: Show Answer

Q82) Genes that are involved in turning on or off the transcription on a set of genes are called: Show Answer

Q83) Why is recombinant DNA technology called genetic engineering? Show Answer

Q84) Another popular name of recombinant technology is: Show Answer

Q85) Enzyme which acts like a scissor in genetic engineering is: Show Answer

Q86) A vector is used to carry foreign DNA in genetic engineering. Which one of the following is used as vector? Show Answer

Q87) The most novel vector having 2 sites for RE enzymes are: Show Answer

Q88) Restriction enzymes have been found in: Show Answer

Q89) Which one of the following pairs is correctly matched? Show Answer

Q90) A restriction enzymes breaks bonds between the: Show Answer

Q91) The sub branch of genetic engineering through which disorders are treated is called Gene Therapy. The father of biochemical disorder is: Show Answer

Q92) The Eco-RI enzymes is obtained from: Show Answer

Q93) The DNA whose genes are to be transferred is multiplied through bacterial DNA (vectro or vehicle or carrier to DNA) in genetic engineering. This DNA is called: Show Answer

Q94) Gene which is responsible for synthesis of polypeptide chain is called: Show Answer

Q95) An envelope surrounds the virus in: Show Answer

Q96) During lytic cycle, viral DNA is not affected by nucleases produced by it as: Show Answer

Q97) Restriction endonucleases ECO RI cleaves palindrome site of DNA duplex at: Show Answer

Q98) Which of the following organelles is associated with genetic engineering? Show Answer

Q99) Plants that receive the foreign genes through genetic engineering are called: Show Answer

Q100) A cell coded protein that is formed in response to infection with most animal viruses is called: Show Answer

Q101) Which of the following pairs is correctly matched? Show Answer

Q102) Viruses like herpes virus, Epstein-Barr virus, AIDS, HIV resemble each in being: Show Answer

Q103) AIDS is characterised by: Show Answer

Q104) A sequential expression of a set of human genes occurs, when a steroid molecule binds to the: Show Answer

Q105) During transcription, RNA polymerase holoenzyme binds to a gene promoter and assumes a saddle like structure. What is it's DNA binding sequence? Show Answer

Q106) How do the proto-oncogenes changed to oncogenes? Show Answer

Q107) Which is the initial step in m-RNA maturation process? Show Answer

Q108) The central dogma of protein synthesis in teminism is: Show Answer

Q109) Which of the following correctly defines a transgenic animal: Show Answer

Q110) There are special proteins that help to open up DNA double helix infront of the replication fork. These proteins are: Show Answer

Q111) Exonucleases cleaving nucleotides one at a time from the end of the polynucleotide chain are: Show Answer

Q112) Complete transduction is: Show Answer

Q113) Genetic engineering is possible because: Show Answer

Q114) Two bacteria found to be very useful in genetic engineering experiments are: Show Answer

Q115) At the time of organogenesis genes regulate the process at different levels and a different time due to: Show Answer

Q116) In Negative operon: Show Answer

Q117) Restriction enzymes: Show Answer

Q118) Process of introduction of foreign gene far improving genotype is called: Show Answer

Q119) Which one of the following makes use of RNA as a template to synthesize DNA? Show Answer

Q120) In E. coli, during lactose metabolism repressor binds to: Show Answer

Q121) The genes are responsible for the growth and differentiation in living organisms through the regulation of: Show Answer

Q122) Which of the following is specifically used in genetic engineering? Show Answer

Q123) Restriction endonucleases: Show Answer

Q124) DNA finger printing refers to: Show Answer

Q125) What kind of evidence suggested that man is more closely related with chimpanzee than with other hominoid apes? Show Answer

Q126) In transgenics, expression of transgene in target tissue is determined by: Show Answer

Q127) The Ti plasmid, is often used for making transgenic plants. This plasmid is found in: Show Answer

Q128) The most likely reason for the development of resistance against pesticides in insect damaging a crop is: Show Answer

Q129) Supercoiled DNA can be traced in: Show Answer

Q130) Phosphorus is present in: Show Answer

Q131) In a given DNA segment ATG, ACC, AGG, ACC, CCA, ACA, the first base gets mutated. The effects of this on coding by this DNA segment will result in: Show Answer

Q132) Okazaki fragments are joined in a correct sequence by: Show Answer

Q133) In the lac operon, the structural genes are switched off when: Show Answer

Q134) In lac operon structural gene 'z' is responsible for the synthesis of the enzyme: Show Answer

Q135) When lactose is added to the culture of E. coli, a few of its molecules get into the cells with the help of: Show Answer

Q136) In the lac operon model, lactose molecules function a is: Show Answer

Q137) Protein synthesis in an animal cell occurs: Show Answer

Q138) E. coli cells with a mutated z gene of the lac operon cannot grow in medium containing only lactose as the source of energy because: Show Answer

Q139) Intron transcripts in heterogenous nuclear RNA (hn-RNA) are removed and exon transcripts are joined together under the direction of protein complexes. These complexes are: Show Answer

Q140) In regulation of gene expression in prokarytoes:
(a) Lactose acts as the suppressor for gene expression
(b) Tryptophan acts as the inducer for gene expression
(c) Regulator gene is the one that produces the repressor molecule Show Answer

Q141) Which of the following acts as genetic material in retro viruses? Show Answer

Q142) The term genome is used for: Show Answer

Q143) Select correct one: Show Answer

Q144) Regulation of gene activity is carried out by: Show Answer

Q145) In lac operon model, the correct sequence of genes is: Show Answer

Q146) The phenomenon by which the phage DNA exists as part of the host DNA is called: Show Answer

Q147) In operon model, regulator gene functions as: Show Answer

Q148) Genes involved in turning on and off of structural genes are: Show Answer

Q149) Lac operon is related to: Show Answer

Q150) According to the operon concept, the regulator gene regulates chemical reactions in the cell by: Show Answer

Q151) The modern concept of gene is that it is: Show Answer

Q152) Identify the true statements -
I. Pullorum disease of poultry is caused by virus.
II. Drones are produced by parthenogenesis.
III. Heterosis or hybrid vigour is the phenotypic superiority of the hybrid over either of its parents in one or more traits.
IV. A clone contains and expresses genetically engineered gene known as transgene.
V. Cross breeding is practised to develop homozygous pureline. Show Answer

Q153) In a chromosome, there is a specific DNA sequence, responsible for
initiating replication. It is called as: Show Answer

Q154) Given below are two statements regarding RNA polymerase in
prokaryotes.
Statement I : In prokaryotes, RNA polymerase is capable of catalysing
the process of elongation during transcription.
Statement II : RNA polymerase associate transiently with 'Rho' factor to
initiate transcription.
In the light of the above statements, choose the correct answer from the
options given below : Show Answer

Q155) Given below are two statements:
Statement I: In eukaryotes there are three RNA polymerases in the
nucleus in addition to the RNA polymerase found in the organelles.
Statement II: All the three RNA polymerases in eukaryotic nucleus have
different roles.
In the light of the above statements, choose the correct answer from the
options given below: Show Answer

Q156) Given below are two statements :
Statement I : RNA interference takes place in all Eukaryotic organisms
as method of cellular defense.
Statement II : RNAi involves the silencing of a specific mRNA due to a
complementary single-stranded RNA molecule that binds and prevents
translation of mRNA
In the light of the above statements, choose the correct answer from the
options given below. Show Answer

Q157) The lactose present in the growth medium of bacteria is transported to
the cell by the action of Show Answer

Q158) A transcription unit in DNA is defined primarily by the three regions in
DNA and these are with respect to upstream and down stream end; Show Answer

Q159) Which of the following statement is correct regarding the process of
replication in E.coli? Show Answer

Q160) Which one is the correct product of DNA dependent RNA polymerase to
the given template?
3’TACATGGCAAATATCCATTCA5’ Show Answer

Q161) The last chromosome sequenced in Human Genome Project was : Show Answer

Q162) Name the component that binds to the operator region of an operon and
prevents RNA polymerase from transcribing the operon. Show Answer

Q163) Given below are two statements :
Statement I :
The process of copying genetic information from one strand of the DNA
into RNA is termed as transcription.
Statement II :
A transcription unit in DNA is defined primarily by the three regions in
the DNA i.e., a promotor, the structural gene and a terminator.
In the light of the above statements, choose the correct answer from the
options given below : Show Answer

Q164) Which scientist conducted an experiment with 32P and 35S labelled
phages for demonstrating that DNA is the genetic material? Show Answer

Q165) Given below are two statements :
Statement I :
RNA being unstable, mutate at a faster rate.
Statement II :
RNA can directly code for synthesis of proteins hence can easily express
the characters.
In the light of the above statements, choose the correct answer from the
options given below : Show Answer

Q166) Select the correct statements about sickle cell anaemia.
(A) There is a change in gene for beta globin.
(B) In the beta globin, there is valine in the place of Lysine.
(C) It is an example of point mutation.
(D) In the normal gene U is replaced by A.
Choose the correct answer from the options given below : Show Answer

Q167) Which one of the following acts as an inducer for lac operon? Show Answer

Q168) With reference to Hershey and Chase experiments. Select the correct
statements.
(A) Viruses grown in the presence of radioactive phosphorus contained
radioactive DNA.
(B) Viruses grown on radioactive sulphur contained radioactive
proteins.
(C) Viruses grown on radioactive phosphorus contained radioactive
protein.
(D) Viruses grown on radioactive sulphur contained radioactive DNA.
(E) Viruses grown on radioactive protein contained radioactive DNA.
Choose the most appropriate answer from the options given below : Show Answer

Q169) The salient features of genetic code are :
(A) The code is palindromic
(B) UGA act as initiator codon
(C) The code is unambiguous and specific
(D) The code is nearly universal
Choose the most appropriate answer from the options given below : Show Answer

Q170) The phenomenon of pleiotropism refers to Show Answer

Q171) Expressed Sequence Tags (ESTs) refers to Show Answer

Q172) Unequivocal proof that DNA is the genetic material was first proposed
by Show Answer

Q173) What is the role of RNA polymerase III in the process of transcription in
Eukaryotes? Show Answer

Q174) Given below are two statements:
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and shorter life span mutate
and evolve faster.
In the light of the above statements, choose the correct answer from the
options given below: Show Answer

Q175) Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with
some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped
around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the
options given below: Show Answer

Q176) Which one of the following is the sequence on corresponding coding
strand, if the sequence on mRNA formed is as follows
5'AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3'? Show Answer

Q177) In lac operon, z gene codes for: Show Answer

Q178) Given below are two statements.
Statement I:
DNA polymerases catalyses polymerisation only in one direction, that is
5′ → 3′
Statement II :
During replication of DNA, on one strand the replication is continuous
while on the other strand it is discontinuous.
In the light of the above statements, choose the correct answer from the
options given below Show Answer

Q179) f DNA contained sulfur instead of phosphorus and proteins contained
phosphorus instead of sulfur, what would have been the outcome of
Hershey and Chase experiment? Show Answer

Q180) Against the codon 5′ UAC 3′, what would be the sequence of anticodon
on tRNA? Show Answer

Q181) If A and C make 30% and 20% of DNA, respectively, what will be the
percentage composition of T . and G ? Show Answer

Q182) The process of translation of mRNA to proteins begins as soon as : Show Answer

Q183) DNA polymorphism forms the basis of : Show Answer

Q184) Read the following statements and choose the set of correct statements
:
(a) Euchromatin is loosely packed chromatin
(b) Heterochromatin is transcriptionally active
(c) Histone octomer is wrapped by negatively charged DNA in
nucleosome
(d) Histones are rich in lysine and arginine
(e) A typical nucleosome contains 400 bp of DNA helix
Choose the correct answer from the options given below : Show Answer

Q185) If a geneticist uses the blind approach for sequencing the whole
genome of an organism, followed by
assignment of function to different segments, the methodology adopted
by him is called as : Show Answer

Q186) If the length of a DNA molecule is 1.1 metres, what will be the
approximate number of base pairs? Show Answer

Q187) In an E. Coli strain i gene gets mutated and its product can not bind the
inducer molecule. If growth medium
is provided with lactose, what will be the outcome? Show Answer

Q188) DNA strands on a gel stained with ethidium bromide when viewed under
UV radiation, appear as Show Answer

Q189) Identify the correct statement. Show Answer

Q190) What is the role of RNA polymerase III in the process of transcription in
eukaryotes? Show Answer

Q191) DNA fingerprinting involves identifying differences in some specific
regions in DNA sequence, called as Show Answer

Q192) Which is the "Only enzyme" that has "Capability" to catalyse Initiation,
Elongation and Termination in the process of transcription in
prokaryotes? Show Answer

Q193) Which of the following RNAs is not required for the synthesis of
protein? Show Answer

Q194) If Adenine makes 30% of the DNA molecule, what will be the percentage
of Thymine, Guanine and Cytosine in it? Show Answer

Q195) Statement I: The codon 'AUG' codes for methionine and phenylalanine.
Statement II: 'AAA' and 'AAG' both codons code for the amino acid
lysine.
In the light of the above statements, choose the correct answer from the
options given below. Show Answer

Q196) Which one of the following statements about Histones is wrong? Show Answer

Q197) Which of the following statements is correct? Show Answer

Q198) The first phase of translation is Show Answer

Q199) Which scientist experimentally proved that DNA is the sole genetic
material in bacteriophage? Show Answer

Q200) From the following, identify the correct combination of salient features
of Genetic Code :- Show Answer

Q201) In the process of transcription in Eukaryotes, the RNA polymerase I
transcribes :- Show Answer

Q202) What initiation and termination factors are involved in transcription in
Eukaryotes? Show Answer

Q203) What will be the sequence of mRNA produced by the following stretch of
DNA?
3'ATGCATGCATGCATG5' TEMPLATE STRAND
5' TACGTACGTACGTAC3' CODING STRAND Show Answer

Q204) Non-membranous nucleoplasmic structures in
nucleus are the site for active synthesis of Show Answer

Q205) Under which of the following conditions will there be no change in the
reading frame of following mRNA?
5'AACAGCGGUGCUAUU3' Show Answer

Q206) Expressed Sequence Tags (ESTs) refers to: Show Answer

Q207) AGGTATCGCAT is a sequence from the coding strand of a gene. What
will be the corresponding sequence of the transcribed mRNA? Show Answer

Q208) Select the correct match Show Answer

Q209) The experimental proof for semiconservative replication of DNA was
first shown in a Show Answer

Q210) All of the following are part of an operon except Show Answer

Q211) The final proof for DNA as the genetic material came from the
experiments of : Show Answer

Q212) If there are 999 bases in an RNA that codes for a protein with 333
amino acids, and the base at position 901 is deleted such that the
length of the RNA becomes 998 bases, how many codons will be altered
? Show Answer

Q213) During DNA replication, Okazaki fragments are used to elongate Show Answer

Q214) Which of the following RNAs should be most abundant in animal cell ? Show Answer

Q215) Spliceosomes are not found in cells of; Show Answer

Q216) The association of histone H1 with a nucleosome indicates: Show Answer

Q217) Taylor conducted the experiments to prove semiconservative mode of
chromosome replication on Show Answer

Q218) The equivalent of a structural gene is A true breeding plant is Show Answer

Q219) Which of the following rRNAs acts as structural RNA as well as
ribozyme in bacterial Show Answer

Q220) A molecule that can act as a genetic material must fulfill the traits
given, except Show Answer

Q221) DNA- dependent RNA polymerase catalyzes transcription on the strand
of the DNA which is called the Show Answer

Q222) Which one of the following is the starter codon? Show Answer

Q223) Which of the following is required as inducer(s) for the expression of
Lac operon? Show Answer

Q224) A complex of ribosomes attached to a single strand of RNA is known as : Show Answer

Q225) Which one of the following is not applicable to RNA? Show Answer

Q226) Balbiani rings are sites of : Show Answer

Q227) Identify the correct order of organisation of genetic material from
largest to smallest : Show Answer

Q228) Satellite DNA is important because it : Show Answer

Q229) Gen regulation governing lactose operon of E.coli that involves the lac I
gene product is : Show Answer

Q230) In sea urchin DNA,Which is double stranded,17 % of the bases were
shown to be cytosine.The percentage of the other three bases excepted
to be present in this DNA are :- Show Answer