Practice Test

Q1) m-RNA, t-RNA and r-RNA are they types of Show Answer

Q2) m-RNA, t-RNA and r-RNA are present in the organisms which have Show Answer

Q3) The non-genetic RNA formed from Show Answer

Q4) Which of the following is a linear molecule ? Show Answer

Q5) Which of the following is a linear molecule folded at certain regions ? Show Answer

Q6) Which of the following has a hair pin structure ? Show Answer

Q7) Which of the following has a clover leaf structure ? Show Answer

Q8) The most abundant non-genetic RNA is Show Answer

Q9) The least abundant non-genetic RNA is Show Answer

Q10) r-RNA forms about _________ of the total cell RNA. Show Answer

Q11) _________forms about 10-15% of the total cell RNA. Show Answer

Q12) The process of transcription produces Show Answer

Q13) __________ carries activated amino acids to ribosomes. Show Answer

Q14) The most active RNA during translation is Show Answer

Q15) During differentiation, cells with the same DNA: Show Answer

Q16) Non-sense codons are present in: Show Answer

Q17) For deciphering the genetic code, H. G. Khorana synthesized: Show Answer

Q18) RNA- synthesis may be restricted by: Show Answer

Q19) A DNA strand is directly involved in the synthesis of all the following except: Show Answer

Q20) Which one of the following is specific for a amino acid? Show Answer

Q21) Which is required for protein synthesis? Show Answer

Q22) Streptomycin and related antibiotics bind to small sub-units of ribosomes in prokaryotes and they: Show Answer

Q23) Transcription is the process by which: Show Answer

Q24) The one aspect which is not a salient feature of genetic code, is its being: Show Answer

Q25) Transcription is carried out by: Show Answer

Q26) mRNA of eukaryotes is synthesized with the help of: Show Answer

Q27) The first amino acid in any polypeptide chain in prokaryotes is always: Show Answer

Q28) A polypeptide is produced as dictated by mRNA, the number of bases on the mRNA that code for the polypeptide portion containing N-terminal amino acid and next 13 amino acid is: Show Answer

Q29) "Degenerate" codes are when: Show Answer

Q30) The degeneracy in genetic code was found by: Show Answer

Q31) Normally GUG specifies valine amino acid, but when AUG is initiation codon then it specifies which one of the following amino acid? Show Answer

Q32) The site of protein synthesis is: Show Answer

Q33) A sequence of three bases which stands for an amino acid is called: Show Answer

Q34) RNA controls the synthesis of: Show Answer

Q35) If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in its transcript will be: Show Answer

Q36) H. G. Khorana got the Noble Prize on: Show Answer

Q37) The function of a non-sense codon is: Show Answer

Q38) The single stranded strand of nucleotide between a gene and a polypeptide is: Show Answer

Q39) r-RNA is transcribed on DNA template by: Show Answer

Q40) The number of polymerase in eukaryotic and prokaryotic cells are: Show Answer

Q41) Which is not required for polypeptide synthesis? Show Answer

Q42) Which is the correct sequence of code transfer involved in the formation of a polypeptide? Show Answer

Q43) The flow of information from DNA to mRNA is called: Show Answer

Q44) The genetic code is called degenerate code because: Show Answer

Q45) The first translated codon in any mRNA is always: Show Answer

Q46) m-RNA is produced in the: Show Answer

Q47) The synthesis of polypeptide chain begins at the: Show Answer

Q48) Cracking the genetic code in vitro was largely the work of: Show Answer

Q49) Lac-operon is related to: Show Answer

Q50) Which site of tRNA molecule hydrogen binds to a mRNA molecule? Show Answer

Q51) Which one of the following pair is correctly matched? Show Answer

Q52) A gene which synthesizes a repressor protein is: Show Answer

Q53) In an operon, the RNA polymerase binds to: Show Answer

Q54) An antibiotic which inhibits translation in eukaryotes is: Show Answer

Q55) In general bacterial genes are regulated at the time of: Show Answer

Q56) The activity of repressor depends upon whether: Show Answer

Q57) The genetic code was cracked by: Show Answer

Q58) During protein synthesis, amino acids recognize and get attached to t-RNA with help of: Show Answer

Q59) Each codon present on m-RNA and anticodon present on t-RNA is composed of: Show Answer

Q60) After reaching the cytoplasm the mRNA attaches itself to: Show Answer

Q61) Which of the following enzymes is required for DNA to RNA formation? Show Answer

Q62) Aminoacyl synthetase enzyme takes part in: Show Answer

Q63) During protein synthesis peptide bond is established between: Show Answer

Q64) Because the amino acids are represented by more than one codon, the genetic code is said to be: Show Answer

Q65) Names-Nirenberg, Ochoa, Gamow, Khorana, Crick bring to your mind: Show Answer

Q66) Initiation of polypeptide chain in protein synthesis is induced by: Show Answer

Q67) Reference transcription in eukaryotes : What is the correct relation? Show Answer

Q68) Which of the following antibiotics prevent polypeptide chain elongation in eukaryotes but not in bacteria? Show Answer

Q69) As per template theory, amino acid first combines with: Show Answer

Q70) During protein synthesis amino acids recognise and get attached to tRNA with the help of: Show Answer

Q71) Genetic code consists of: Show Answer

Q72) The Tryptophan operon is an example of: Show Answer

Q73) Because most of the amino acids are represented by more than one codon the genetic code is said to be: Show Answer

Q74) During elongation of polypeptide chain, sigma factor is: Show Answer

Q75) In recent years, considerable attention is being given to DNA protein interactions, because expression of genes is regulated through binding of specific proteins on regulatory DNA sequences. The pattern of protein binding of DNA can be studied by: Show Answer

Q76) Protein synthesis in an animal cell takes place: Show Answer

Q77) Which step of translation does not consume a high energy phosphate bond? Show Answer

Q78) Three codons causing chain termination are: Show Answer

Q79) In eukaryotes, after transcription of mRNA, some of its nucleotides are removed before it is translated into polypeptide. The nucleotides which are removed from mRNA are called: Show Answer

Q80) Proteins are synthesised by the process: Show Answer

Q81) Correct sequence of code transfer during polypeptide formation is: Show Answer

Q82) Protein synthesis occurs: Show Answer

Q83) Types of RNA polymerase required in nucleus for RNA synthesis in eukaryotes: Show Answer

Q84) Degeneration of a genetic code is attributed to the: Show Answer

Q85) During translation initiation in prokaryotes, a GTP molecule is needed in: Show Answer

Q86) During transcription, the DNA site at which RNA polymerase binds is called: Show Answer

Q87) The function of promoter of lac-operon is to: Show Answer

Q88) During transcription, if nucleotide sequence of DNA strand, that is being coded is ATACG, then the nucleotide sequence in m-RNA would be: Show Answer

Q89) In the genetic code dictionary, how many codons are used to code for all the 20 essential amino acids? Show Answer

Q90) Which one of the following triplet codes is correctly matched with its sepecificity for an amino acid in protein synthesis or as 'start' of 'stop' signal? Show Answer

Q91) The codon for anticodon 3'UUA5' is: Show Answer

Q92) Splicing of RNA depends on: Show Answer

Q93) In lac operon system, lac gene-I codes for: Show Answer

Q94) Which of the following is important for transcription? Show Answer

Q95) E.coli vells with a mutated Z gene of the lac operon cannot grow in medium containing only lactose as the source of energy because: Show Answer

Q96) In the synthesis of which of the following, the DNA molecule is not directly involved? Show Answer

Q97) Transcription requires which of these enzyme? Show Answer

Q98) Genes that are continuously functional and whose regulations are at tissue level as in kidney, liver are known as: Show Answer

Q99) Which antibiotic inhibits interaction between tRNA and mRNA during bacterial protein synthesis? Show Answer

Q100) Amino acid sequence, in protein synthesis is decided by the sequence of: Show Answer

Q101) During protein synthesis in an organism at one point the process comes to a halt. Select the group of the three codons from the following, from which any one of the three could bring about this halt. Show Answer

Q102) A sequential expression of a set of human genes occurs when a steriod molecule binds to the: Show Answer

Q103) During transcription, RNA polymerase holoenzyme binds to a gene promotor and assumes a saddle-like structure. What is it's DNA-binding sequence? Show Answer

Q104) Molecular basis of organ differentiation depends on the modulation in transcription by: Show Answer

Q105) Polysomes formed by: Show Answer

Q106) Tetracycline inhibits protein synthesis in bacteria by inhibiting: Show Answer

Q107) Co-repressor is a: Show Answer

Q108) Reverse transcription was discovered by: Show Answer

Q109) In the Operon concept, the regulator gene regulates chemical reactions in the cell by: Show Answer

Q110) Central dogma of cytogenetics is: Show Answer

Q111) In an E. coli according to Operon concept, an operator gene combines with: Show Answer

Q112) Exons and introns are parts of: Show Answer

Q113) Eukaryotes have: Show Answer

Q114) According to Operon concept, regulator gene form: Show Answer

Q115) Which virus has a double stranded RNA? Show Answer

Q116) In lysogenic cycle, the virus is: Show Answer

Q117) In bacteria, exchange of genetic material between two different cells is brought by the process of: Show Answer

Q118) Phage host represents: Show Answer

Q119) Regulated unit of genetic material is called: Show Answer

Q120) A retrovirus is: Show Answer

Q121) Bacteriophages are: Show Answer

Q122) Provirus differs from prophage with regard to: Show Answer

Q123) Which virus has a rod shaped structure? Show Answer

Q124) Who found occurrence of sexuality in bacteria? Show Answer

Q125) Operon consists of following: Show Answer

Q126) Restriction enzymes are used in genetic engineering because: Show Answer

Q127) Wild type E.coli cells are growing in a normal medium with glucose. They are transferred to medium containing only lactose as the sugar. Which one of the following changes take place? Show Answer

Q128) An environmental agent that triggers transcription from an operon is a: Show Answer

Q129) The lac operon is an example of: Show Answer

Q130) In split genes, the coding sequences are called: Show Answer

Q131) In case of cyanobacteria: Show Answer

Q132) The sequence of structural genes of Lac operon is: Show Answer

Q133) Which virus has a single stranded DNA: Show Answer

Q134) Resistance to antibiotics is a genetic trait that spreads naturally from one type of bacterium to: Show Answer

Q135) Reverse transcriptase is: Show Answer

Q136) Transduction in bacteria is mediated by: Show Answer

Q137) When DNA is exchanged between two bacteria via cytoplasmic bridges, the process is called: Show Answer

Q138) In general, bacterial genes are regulated at the time of: Show Answer

Q139) The activity of a repressor depends on whether: Show Answer

Q140) A gene carried by recombinant DNA is cloned when: Show Answer

Q141) A piece of nucleic acid used to find a gene, by forming a hybrid with it, is called as: Show Answer

Q142) Which of these viruses has DNA that occurs in both linear form and circular form? Show Answer

Q143) Palindromic sequence are recognized by enzymes: Show Answer

Q144) Which of the following is a palindromic sequence of nucleotides? Show Answer

Q145) Restriction enzymes are nucleases and: Show Answer

Q146) Which is must for genetic engineering? Show Answer

Q147) Restriction endonuclease enzymes (RE) also called microscissors are widely used in genetic engineering. They cleave up foreign DNA at specific sites. These enzymes are synthesized by: Show Answer

Q148) Restriction endonuclease are enzymes discovered by Arber and Mathani (1962) and obtained from bacteria only. They are used as microscissors in genetic engineering. They recognise specific sequence of bases at a particular site, usually 4-6 base pairs and: Show Answer

Q149) Sticky ends of DNA strand are: Show Answer

Q150) One important consequence of interference of gene expression by another gene may be: Show Answer

Q151) In the Tryptophan operon, Tryptophan acts as: Show Answer

Q152) Enzymes required at the time e.g., for respiration are called: Show Answer

Q153) Two scientists working in Pasteur Institute proposed a gene action model and got Nobel Prize in 1965. Names: Show Answer

Q154) How does gene expression occur in prokaryotes? Show Answer

Q155) A split gene is: Show Answer

Q156) Gene expression in eukaryotes at a time never exceeds: Show Answer

Q157) When lactose is present: Show Answer

Q158) Introns occurs in: Show Answer

Q159) According to 1991 figures, about how many human genes have been mapped? Show Answer

Q160) Lac, operon of E. coli contains in continuity: Show Answer

Q161) Bacterial resistance to antibiotic is a genetic trait carried in the bacterial: Show Answer

Q162) In a tryptophan operon model, formation of tryptophan is restricted by: Show Answer

Q163) How many types of the genes the Lac operon model includes: Show Answer

Q164) In a lac-operon model, the addition of lactose induces the synthesis of: Show Answer

Q165) A collection of clones (genetically similar cells/organisms) having recombinant DNA is called: Show Answer

Q166) Dr. Hargobind Khorana has been awarded Nobels prize for research on: Show Answer

Q167) Two strains of bacterial suspensions are separated from one another with the help of bacteria proof glass filters, which of the following process would not occur? Show Answer

Q168) Each codon present on m-RNA and anticodon present in t-RNA is composed of: Show Answer

Q169) Which of the following unit is unrelated to DNA or gene? Show Answer

Q170) The basis for DNA finger printing is: Show Answer

Q171) The recent techinque used for separating fragments of DNA is: Show Answer

Q172) Genes that are involved in turning on or off the transcription on a set of genes are called: Show Answer

Q173) Why is recombinant DNA technology called genetic engineering? Show Answer

Q174) Another popular name of recombinant technology is: Show Answer

Q175) Enzyme which acts like a scissor in genetic engineering is: Show Answer

Q176) A vector is used to carry foreign DNA in genetic engineering. Which one of the following is used as vector? Show Answer

Q177) The most novel vector having 2 sites for RE enzymes are: Show Answer

Q178) Restriction enzymes have been found in: Show Answer

Q179) Which one of the following pairs is correctly matched? Show Answer

Q180) A restriction enzymes breaks bonds between the: Show Answer

Q181) The Eco-RI enzymes is obtained from: Show Answer

Q182) The DNA whose genes are to be transferred is multiplied through bacterial DNA (vectro or vehicle or carrier to DNA) in genetic engineering. This DNA is called: Show Answer

Q183) Gene which is responsible for synthesis of polypeptide chain is called: Show Answer

Q184) An envelope surrounds the virus in: Show Answer

Q185) During lytic cycle, viral DNA is not affected by nucleases produced by it as: Show Answer

Q186) Restriction endonucleases ECO RI cleaves palindrome site of DNA duplex at: Show Answer

Q187) Which of the following organelles is associated with genetic engineering? Show Answer

Q188) Which of the following pairs is correctly matched? Show Answer

Q189) Viruses like herpes virus, Epstein-Barr virus, AIDS, HIV resemble each in being: Show Answer

Q190) A sequential expression of a set of human genes occurs, when a steroid molecule binds to the: Show Answer

Q191) During transcription, RNA polymerase holoenzyme binds to a gene promoter and assumes a saddle like structure. What is it's DNA binding sequence? Show Answer

Q192) Which is the initial step in m-RNA maturation process? Show Answer

Q193) The central dogma of protein synthesis in teminism is: Show Answer

Q194) There are special proteins that help to open up DNA double helix infront of the replication fork. These proteins are: Show Answer

Q195) Complete transduction is: Show Answer

Q196) Genetic engineering is possible because: Show Answer

Q197) Two bacteria found to be very useful in genetic engineering experiments are: Show Answer

Q198) At the time of organogenesis genes regulate the process at different levels and a different time due to: Show Answer

Q199) In Negative operon: Show Answer

Q200) Restriction enzymes: Show Answer

Q201) Process of introduction of foreign gene far improving genotype is called: Show Answer

Q202) Which one of the following makes use of RNA as a template to synthesize DNA? Show Answer

Q203) In E. coli, during lactose metabolism repressor binds to: Show Answer

Q204) The genes are responsible for the growth and differentiation in living organisms through the regulation of: Show Answer

Q205) Which of the following is specifically used in genetic engineering? Show Answer

Q206) Restriction endonucleases: Show Answer

Q207) DNA finger printing refers to: Show Answer

Q208) In transgenics, expression of transgene in target tissue is determined by: Show Answer

Q209) The Ti plasmid, is often used for making transgenic plants. This plasmid is found in: Show Answer

Q210) Supercoiled DNA can be traced in: Show Answer

Q211) Okazaki fragments are joined in a correct sequence by: Show Answer

Q212) In the lac operon, the structural genes are switched off when: Show Answer

Q213) In lac operon structural gene 'z' is responsible for the synthesis of the enzyme: Show Answer

Q214) When lactose is added to the culture of E. coli, a few of its molecules get into the cells with the help of: Show Answer

Q215) In the lac operon model, lactose molecules function a is: Show Answer

Q216) E. coli cells with a mutated z gene of the lac operon cannot grow in medium containing only lactose as the source of energy because: Show Answer

Q217) Intron transcripts in heterogenous nuclear RNA (hn-RNA) are removed and exon transcripts are joined together under the direction of protein complexes. These complexes are: Show Answer

Q218) In regulation of gene expression in prokarytoes:
(a) Lactose acts as the suppressor for gene expression
(b) Tryptophan acts as the inducer for gene expression
(c) Regulator gene is the one that produces the repressor molecule Show Answer

Q219) Which of the following acts as genetic material in retro viruses? Show Answer

Q220) The term genome is used for: Show Answer

Q221) Select correct one: Show Answer

Q222) Regulation of gene activity is carried out by: Show Answer

Q223) In lac operon model, the correct sequence of genes is: Show Answer

Q224) The phenomenon by which the phage DNA exists as part of the host DNA is called: Show Answer

Q225) In operon model, regulator gene functions as: Show Answer

Q226) Genes involved in turning on and off of structural genes are: Show Answer

Q227) Lac operon is related to: Show Answer

Q228) According to the operon concept, the regulator gene regulates chemical reactions in the cell by: Show Answer

Q229) The modern concept of gene is that it is: Show Answer

Q230) In a hypothetical mRNA, the codon would normally be translated as follows:
UUG : Leu,
UUG : Leu,
UUU : Val,
UGU : Cys,
UAU : Tyr
If single G-residue is inserted between the second and 3rd bases: Show Answer

Q231) The minimum length of cistron in base pairs which synthesizes a polypeptide of 50 amino acids is: Show Answer

Q232) TATAATG sequence near the RNA start point of prokaryotic promoter is: Show Answer

Q233) An environmental agent that triggers transcription from an operon is a: Show Answer

Q234) RNA processing is: Show Answer

Q235) Which of the following statements is/are incorrect about tRNA?
A. It binds to DNA, initiating translation.
B. It has a greater molecular weight than mRNA.
C. It transfers the code from the nucleus to cytoplasm.
D. There is at-least one form for each kind of amino-acid. Show Answer

Q236) Transcription is most similar to Show Answer

Q237) Gene regulation governing lactose operon of E. coli that involves the lac I gene product is Show Answer

Q238) Three types of RNA involved in comparising the structural and functional role for protein synthesis, serving as a template for translation, and transporting amino acid, respectively are Show Answer

Q239) The prediction of sequence of amino acid is ____A____ if the sequence of nucleotides of mRNA is known. The prediction of sequence of nucleotide is concerned mRNA is ____B____ because the genetic code is ____C____. Show Answer

Q240) A very low level of expression of lac operon has to be present in the cell all the time, otherwise Show Answer

Q241) Which one is false? Show Answer

Q242) Identify the true statements -
I. Pullorum disease of poultry is caused by virus.
II. Drones are produced by parthenogenesis.
III. Heterosis or hybrid vigour is the phenotypic superiority of the hybrid over either of its parents in one or more traits.
IV. A clone contains and expresses genetically engineered gene known as transgene.
V. Cross breeding is practised to develop homozygous pureline. Show Answer

Q243) In three dimensional view the molecule of
t-RNA is Show Answer

Q244) Anticodon occurs in Show Answer

Q245) Which form of RNA has a structure
resembling clover leaf ? Show Answer

Q246) Amino acid sequence, in protein synthesis
is decided by the sequence of Show Answer

Q247) Which antibiotic inhibits interaction
between tRNA and wRNA during bacterial
protein synthesis? Show Answer

Q248) hnRNA undergoes two additional processing. Out of which, in one of them an unusual nucleotide (methyl
guanosine triphosphate) is added to the 5’ – end of hnRNA. This is known as Show Answer

Q249) Amino acid binding site in tRNA is Show Answer

Q250) Which of the following constitutes about 10-20 of total cellular RNA? Show Answer

Q251) DNA sequence that code for protein are known as Show Answer

Q252) Which is the initial step in mRNA maturation process? Show Answer

Q253) DNA acts as a template for synthesis of Show Answer

Q254) Sequence of DNA (non- coding) is known as Show Answer

Q255) Which one is referred to as soluble RNA? Show Answer

Q256) If a DNA sequence is same as that of a mRNA copy that is translated into protein, it is called Show Answer

Q257) How many binding sites does ribosome have for tRNA molecules? Show Answer

Q258) Clover leaf secondary structure of tRNA has anticodon arm which Show Answer

Q259) Which factor is important for termination of transcription?
Show Answer

Q260) In a chromosome, there is a specific DNA sequence, responsible for
initiating replication. It is called as: Show Answer

Q261) Given below are two statements regarding RNA polymerase in
prokaryotes.
Statement I : In prokaryotes, RNA polymerase is capable of catalysing
the process of elongation during transcription.
Statement II : RNA polymerase associate transiently with 'Rho' factor to
initiate transcription.
In the light of the above statements, choose the correct answer from the
options given below : Show Answer

Q262) Given below are two statements:
Statement I: In eukaryotes there are three RNA polymerases in the
nucleus in addition to the RNA polymerase found in the organelles.
Statement II: All the three RNA polymerases in eukaryotic nucleus have
different roles.
In the light of the above statements, choose the correct answer from the
options given below: Show Answer

Q263) Given below are two statements :
Statement I : RNA interference takes place in all Eukaryotic organisms
as method of cellular defense.
Statement II : RNAi involves the silencing of a specific mRNA due to a
complementary single-stranded RNA molecule that binds and prevents
translation of mRNA
In the light of the above statements, choose the correct answer from the
options given below. Show Answer

Q264) The lactose present in the growth medium of bacteria is transported to
the cell by the action of Show Answer

Q265) A transcription unit in DNA is defined primarily by the three regions in
DNA and these are with respect to upstream and down stream end; Show Answer

Q266) Which of the following statement is correct regarding the process of
replication in E.coli? Show Answer

Q267) Which one is the correct product of DNA dependent RNA polymerase to
the given template?
3’TACATGGCAAATATCCATTCA5’ Show Answer

Q268) The last chromosome sequenced in Human Genome Project was : Show Answer

Q269) Name the component that binds to the operator region of an operon and
prevents RNA polymerase from transcribing the operon. Show Answer

Q270) Given below are two statements :
Statement I :
The process of copying genetic information from one strand of the DNA
into RNA is termed as transcription.
Statement II :
A transcription unit in DNA is defined primarily by the three regions in
the DNA i.e., a promotor, the structural gene and a terminator.
In the light of the above statements, choose the correct answer from the
options given below : Show Answer

Q271) Which scientist conducted an experiment with 32P and 35S labelled
phages for demonstrating that DNA is the genetic material? Show Answer

Q272) Given below are two statements :
Statement I :
RNA being unstable, mutate at a faster rate.
Statement II :
RNA can directly code for synthesis of proteins hence can easily express
the characters.
In the light of the above statements, choose the correct answer from the
options given below : Show Answer

Q273) Which one of the following acts as an inducer for lac operon? Show Answer

Q274) With reference to Hershey and Chase experiments. Select the correct
statements.
(A) Viruses grown in the presence of radioactive phosphorus contained
radioactive DNA.
(B) Viruses grown on radioactive sulphur contained radioactive
proteins.
(C) Viruses grown on radioactive phosphorus contained radioactive
protein.
(D) Viruses grown on radioactive sulphur contained radioactive DNA.
(E) Viruses grown on radioactive protein contained radioactive DNA.
Choose the most appropriate answer from the options given below : Show Answer

Q275) The salient features of genetic code are :
(A) The code is palindromic
(B) UGA act as initiator codon
(C) The code is unambiguous and specific
(D) The code is nearly universal
Choose the most appropriate answer from the options given below : Show Answer

Q276) Expressed Sequence Tags (ESTs) refers to Show Answer

Q277) Unequivocal proof that DNA is the genetic material was first proposed
by Show Answer

Q278) What is the role of RNA polymerase III in the process of transcription in
Eukaryotes? Show Answer

Q279) Given below are two statements:
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and shorter life span mutate
and evolve faster.
In the light of the above statements, choose the correct answer from the
options given below: Show Answer

Q280) Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with
some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped
around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the
options given below: Show Answer

Q281) Which one of the following is the sequence on corresponding coding
strand, if the sequence on mRNA formed is as follows
5'AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3'? Show Answer

Q282) In lac operon, z gene codes for: Show Answer

Q283) Given below are two statements.
Statement I:
DNA polymerases catalyses polymerisation only in one direction, that is
5′ → 3′
Statement II :
During replication of DNA, on one strand the replication is continuous
while on the other strand it is discontinuous.
In the light of the above statements, choose the correct answer from the
options given below Show Answer

Q284) f DNA contained sulfur instead of phosphorus and proteins contained
phosphorus instead of sulfur, what would have been the outcome of
Hershey and Chase experiment? Show Answer

Q285) Against the codon 5′ UAC 3′, what would be the sequence of anticodon
on tRNA? Show Answer

Q286) The process of translation of mRNA to proteins begins as soon as : Show Answer

Q287) DNA polymorphism forms the basis of : Show Answer

Q288) Read the following statements and choose the set of correct statements
:
(a) Euchromatin is loosely packed chromatin
(b) Heterochromatin is transcriptionally active
(c) Histone octomer is wrapped by negatively charged DNA in
nucleosome
(d) Histones are rich in lysine and arginine
(e) A typical nucleosome contains 400 bp of DNA helix
Choose the correct answer from the options given below : Show Answer

Q289) If a geneticist uses the blind approach for sequencing the whole
genome of an organism, followed by
assignment of function to different segments, the methodology adopted
by him is called as : Show Answer

Q290) In an E. Coli strain i gene gets mutated and its product can not bind the
inducer molecule. If growth medium
is provided with lactose, what will be the outcome? Show Answer

Q291) DNA strands on a gel stained with ethidium bromide when viewed under
UV radiation, appear as Show Answer

Q292) Identify the correct statement. Show Answer

Q293) What is the role of RNA polymerase III in the process of transcription in
eukaryotes? Show Answer

Q294) DNA fingerprinting involves identifying differences in some specific
regions in DNA sequence, called as Show Answer

Q295) Which is the "Only enzyme" that has "Capability" to catalyse Initiation,
Elongation and Termination in the process of transcription in
prokaryotes? Show Answer

Q296) Which of the following RNAs is not required for the synthesis of
protein? Show Answer

Q297) Statement I: The codon 'AUG' codes for methionine and phenylalanine.
Statement II: 'AAA' and 'AAG' both codons code for the amino acid
lysine.
In the light of the above statements, choose the correct answer from the
options given below. Show Answer

Q298) Which one of the following statements about Histones is wrong? Show Answer

Q299) The first phase of translation is Show Answer

Q300) Which scientist experimentally proved that DNA is the sole genetic
material in bacteriophage? Show Answer

Q301) From the following, identify the correct combination of salient features
of Genetic Code :- Show Answer

Q302) In the process of transcription in Eukaryotes, the RNA polymerase I
transcribes :- Show Answer

Q303) What initiation and termination factors are involved in transcription in
Eukaryotes? Show Answer

Q304) What will be the sequence of mRNA produced by the following stretch of
DNA?
3'ATGCATGCATGCATG5' TEMPLATE STRAND
5' TACGTACGTACGTAC3' CODING STRAND Show Answer

Q305) Expressed Sequence Tags (ESTs) refers to: Show Answer

Q306) AGGTATCGCAT is a sequence from the coding strand of a gene. What
will be the corresponding sequence of the transcribed mRNA? Show Answer

Q307) Select the correct match Show Answer

Q308) The experimental proof for semiconservative replication of DNA was
first shown in a Show Answer

Q309) All of the following are part of an operon except Show Answer

Q310) The final proof for DNA as the genetic material came from the
experiments of : Show Answer

Q311) During DNA replication, Okazaki fragments are used to elongate Show Answer

Q312) Which of the following RNAs should be most abundant in animal cell ? Show Answer

Q313) Spliceosomes are not found in cells of; Show Answer

Q314) The association of histone H1 with a nucleosome indicates: Show Answer

Q315) Taylor conducted the experiments to prove semiconservative mode of
chromosome replication on Show Answer

Q316) The equivalent of a structural gene is A true breeding plant is Show Answer

Q317) Which of the following rRNAs acts as structural RNA as well as
ribozyme in bacterial Show Answer

Q318) A molecule that can act as a genetic material must fulfill the traits
given, except Show Answer

Q319) DNA- dependent RNA polymerase catalyzes transcription on the strand
of the DNA which is called the Show Answer

Q320) Which one of the following is the starter codon? Show Answer

Q321) Which of the following is required as inducer(s) for the expression of
Lac operon? Show Answer

Q322) Balbiani rings are sites of : Show Answer

Q323) Identify the correct order of organisation of genetic material from
largest to smallest : Show Answer

Q324) Satellite DNA is important because it : Show Answer

Q325) Gen regulation governing lactose operon of E.coli that involves the lac I
gene product is : Show Answer

Q326) Given below are two statements :
Statement I: In the lac operon, the z gene codes for beta-galactosidase
which is primarily responsible for the hydrolysis of lactose into
galactose and glucose.
Statement II: In addition to lactose, glucose or galactose can also
induce lac operon.
In the light of the above statements, choose the correct answer from the
options given below : Show Answer